Information of ICE
| ICEberg ID | 242_IME |
|---|---|
| ICE Name | Tn4555 |
| ICEO ID | - |
| Organism | Bacteroides vulgatus CLA341 |
| Size | 12105 bp |
| GC Content (%) | 44.27 |
| Insertion site | AT-rich regions |
| Function | R Beta-lactam |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | U75371 (complete IME sequence in this GenBank file) |
| Coordinates | 1..12105 |
| Putative oriT region | coordinates: 6390..6563; oriTDB id: 200008 GATTTAGACCTTGTGCTGGTCGGTGCATCTCCAATCGGCAACGATGATGAAAAACCTCCC TGACGGAGGAGAGCGGAAGCCGTAGGCTGGAGTTTGCAGACAATGGCTTGCCATTGATAT AGCCCACTATAACTACACGCTCCGCTTACGTAGTTGTGGGCTCTCCCGAGGG |
| Putative relaxase | - |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of Tn4555 components from U75371
Complete gene list of Tn4555 from U75371
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The Interaction Network among ICE/IME/CIME
Detailed Informatioin of the Interaction Network
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
|---|---|---|---|---|---|---|
| 1 | Tn4555 | CTn341 [ICE] |  in trans | Bacteroides vulgatus | Escherichia coli | 14702313 |
| 2 | Tn4555 | CTnDOT [ICE] | in trans | Bacteroides | Bacteroides | 8386723 |
| 3 | Tn4555 | RK2 [IncP plasmid] | in trans | Escherichia coli | Escherichia coli | 8386723 |
| 4 | Tn4555 | R751 [IncP plasmid] | in trans | Escherichia coli | Escherichia coli | 8386723 |
| (1) Bass KA, Hecht DW. (2002) Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 2002 Apr;184(7):1895-904. [PubMed:11889096] |
| (2) Smith CJ, Parker AC. (1993) Identification of a circular intermediate in the transfer and transposition of Tn4555, a mobilizable transposon from Bacteroides spp. J Bacteriol. 1993 May;175(9):2682-91. [PubMed:8386723] |
| (3) Smith CJ, Parker AC. (1996) A gene product related to Tral is required for the mobilization of Bacteroides mobilizable transposons and plasmids. Mol Microbiol. 1996 May;20(4):741-50. [PubMed:8793871] |
| (4) Tribble GD, Parker AC, Smith CJ. (1997) The Bacteroides mobilizable transposon Tn4555 integrates by a site-specific recombination mechanism similar to that of the gram-positive bacterial element Tn916. J Bacteriol. 1997 Apr;179(8):2731-9. [PubMed:9098073] |
| (5) Ferreira LQ, Avelar KE, Vieira JM, de Paula GR, Colombo AP, Domingues RM, Ferreira MC. (2007) Association between the cfxA gene and transposon Tn4555 in Bacteroides distasonis strains and other Bacteroides species. Curr Microbiol. 2007 May;54(5):348-53. [PubMed:17486409] |
| (6) Bellanger X, Payot S, Leblond-Bourget N, Guédon G. (2014) Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 2014 Jul;38(4):720-60. [PubMed:24372381] |
| (7) Guédon G, Libante V, Coluzzi C, Payot S, Leblond-Bourget N. (2017) The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 2017 Nov 22;8(11):337. [PubMed:29165361] |