Information of ICE
| ICEberg ID | 194_IME |
|---|---|
| ICE Name | NBU2 |
| ICEO ID | - |
| Organism | Bacteroides fragilis |
| Size | 11123 bp |
| GC Content (%) | 42.52 |
| Insertion site | 3′ of two tRNASer genes |
| Function | linA2N2 |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | AF251288 (complete IME sequence in this GenBank file) |
| Coordinates | 1..11123 |
| Putative oriT region | coordinates: 8812..9030; oriTDB id: 200011 CGCATGGAATACGGCAGAGAGCGGTACATCCGGGACGCTTCGCAGATTTACAGAGGATGC AAGGACTTGAACGAATACTTACAGAAACAGATTGAAAGAAAAAGGCAGCTCCAGTCCGCC AAAGGGGTGCGCAGCCAATCACCGGAAAAGAAGAACGGCTTCCAGTTATAGCCCACTATA ACTACACGCTTCGCTTTCGTAGTTGTGGGCTCTCCCG |
| Putative relaxase | coordinates: 9137..10543; Family: - |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of NBU2 components from AF251288
Complete gene list of NBU2 from AF251288
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The Interaction Network among ICE/IME/CIME

Detailed Informatioin of the Interaction Network
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
|---|---|---|---|---|---|---|
| 1 | NBU2 | CTnERL [ICE] | | Bacteroides fragilis; Bacteroides uniformis; Bacteroides thetaiotaomicron | Bacteroides thetaiotaomicron 5482; Bacteroides uniformis; Escherichia coli | 8407835;7608064;10852890 |
| 2 | NBU2 | RP4 [IncP plasmid] | | Escherichia coli | E. coli HB101 | 7608064 |
| 3 | NBU2 | R751 [IncP plasmid] | | Escherichia coli | E. coli HB101 | 7608064 |
| 4 | NBU2 | CTnDOT [ICE] | | Bacteroides thetaiotaomicron; Bacteroides uniformis | Bacteroides thetaiotaomicron 5482 | 8407835 |
| (1) Bass KA, Hecht DW. (2002) Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 2002 Apr;184(7):1895-904. [PubMed:11889096] |
| (2) Wang J, Shoemaker NB, Wang GR, Salyers AA. (2000) Characterization of a Bacteroides mobilizable transposon, NBU2, which carries a functional lincomycin resistance gene. J Bacteriol. 2000 Jun;182(12):3559-71. [PubMed:10852890] |
| (3) Bellanger X, Payot S, Leblond-Bourget N, Guédon G. (2014) Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 2014 Jul;38(4):720-60. [PubMed:24372381] |
| (4) Guédon G, Libante V, Coluzzi C, Payot S, Leblond-Bourget N. (2017) The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 2017 Nov 22;8(11):337. [PubMed:29165361] |