Information of ICE
| ICEberg ID | 178_IME |
|---|---|
| ICE Name | MGIVflInd1 |
| ICEO ID | - |
| Organism | Vibrio fluvialis H-08942 |
| Size | 23229 bp |
| GC Content (%) | 46.51 |
| Insertion site | 3′ end of yicC |
| Function | D Restriction-Modification |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | KC117176 (complete IME sequence in this GenBank file) |
| Coordinates | 1..23229 |
| Putative oriT region | coordinates: 5288..5355; oriTDB id: 200056 CCCCATGCCTTTACCCCCATACGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACG CCAAAC |
| Putative relaxase | - |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of MGIVflInd1 components from KC117176
Complete gene list of MGIVflInd1 from KC117176
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The Interaction Network among ICE/IME/CIME
Detailed Informatioin of the Interaction Network
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
|---|---|---|---|---|---|---|
| 1 | MGIVflInd1 | ICEVflInd1 [ICE] |  in trans | Vibrio fluvialis; E. coli CAG18439 | Escherichia coli | 20807202;23204461 |
| 2 | MGIVflInd1 | SXT [ICE] | in trans | E. coli AD64 | E. coli CAG18439 | 20807202 |
| (1) Daccord A, Ceccarelli D, Rodrigue S, Burrus V. (2013) Comparative analysis of mobilizable genomic islands. J Bacteriol. 2013 Feb;195(3):606-14. [PubMed:23204461] |
| (2) Daccord A, Ceccarelli D, Burrus V. (2010) Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 2010 Nov;78(3):576-88. [PubMed:20807202] |
| (3) Daccord A, Ceccarelli D, Rodrigue S, Burrus V. (2013) Comparative analysis of mobilizable genomic islands. J Bacteriol. 2013 Feb;195(3):606-14. [PubMed:23204461] |
| (4) Bellanger X, Payot S, Leblond-Bourget N, Guédon G. (2014) Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 2014 Jul;38(4):720-60. [PubMed:24372381] |
| (5) Guédon G, Libante V, Coluzzi C, Payot S, Leblond-Bourget N. (2017) The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 2017 Nov 22;8(11):337. [PubMed:29165361] |