Information of ICE
ICEberg ID | 44 |
---|---|
ICE Name | SXT(MO10) |
ICEO ID | ICEO_0000017 |
Organism | Vibrio cholerae O139 MO10 |
Size | 99483 bp |
GC Content (%) | 47.05 |
Insertion site | prfC |
Function | R Sulfamethoxazole, trimethoprim, chloramphenicol, and streptomycin D Bacteriophage Exclusion D Toxin-Antitoxin System |
Species that ICE can be transferred to | Vibrio cholerae; Escherichia coli; Salmonella enterica serovar Typhimurium |
Nucleotide Sequence | AY055428 (complete ICE sequence in this GenBank file) |
Coordinates | 1..99483 |
Putative oriT region | coordinates: 3692..3798; oriTDB id: 200056 TCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGC CAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA |
Putative relaxase | coordinates: 45176..47326; Family: MOBH |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of SXT(MO10) components from AY055428
Complete gene list of SXT(MO10) from AY055428
# | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
---|
The Interaction Network among ICE/IME/CIME

Detailed Informatioin of the Interaction Network
# | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
---|---|---|---|---|---|---|
1 | SXT(MO10) | MGIVchUSA1 [IME] | ![]() | E. coli CAG18420 | E. coli VB112 | 20807202 |
2 | SXT(MO10) | MGIVflInd1 [IME] | ![]() | E. coli AD64 | E. coli CAG18439 | 20807202 |
3 | SXT(MO10) | MGIVvuTai1 [IME] | ![]() | E. coli CAG18420 | E. coli VB112 | 20807202 |
(1) Waldor MK, Tschäpe H, Mekalanos JJ. (1996) A new type of conjugative transposon encodes resistance to sulfamethoxazole, trimethoprim, and streptomycin in Vibrio cholerae O139. J Bacteriol. 1996 Jul;178(14):4157-65. [PubMed:8763944] |
(2) Hochhut B, Waldor MK. (1999) Site-specific integration of the conjugal Vibrio cholerae SXT element into prfC. Mol Microbiol. 1999 Apr;32(1):99-110. [PubMed:10216863] |
(3) Hochhut B, Marrero J, Waldor MK. (2000) Mobilization of plasmids and chromosomal DNA mediated by the SXT element, a constin found in Vibrio cholerae O139. J Bacteriol. 2000 Apr;182(7):2043-7. [PubMed:10715015] |
(4) Hochhut B, Beaber JW, Woodgate R, Waldor MK. (2001) Formation of chromosomal tandem arrays of the SXT element and R391, two conjugative chromosomally integrating elements that share an attachment site. J Bacteriol. 2001 Feb;183(4):1124-32. [PubMed:11157923] |
(5) Hochhut B, Lotfi Y, Mazel D, Faruque SM, Woodgate R, Waldor MK. (2001) Molecular analysis of antibiotic resistance gene clusters in vibrio cholerae O139 and O1 SXT constins. Antimicrob Agents Chemother. 2001 Nov;45(11):2991-3000. [PubMed:11600347] |
(6) Beaber JW, Hochhut B, Waldor MK. (2002) Genomic and functional analyses of SXT, an integrating antibiotic resistance gene transfer element derived from Vibrio cholerae. J Bacteriol. 2002 Aug;184(15):4259-69. [PubMed:12107144] |
(7) Thungapathra M, Amita, Sinha KK, Chaudhuri SR, Garg P, Ramamurthy T, Nair GB, Ghosh A. (2002) Occurrence of antibiotic resistance gene cassettes aac(6')-Ib, dfrA5, dfrA12, and ereA2 in class I integrons in non-O1, non-O139 Vibrio cholerae strains in India. Antimicrob Agents Chemother. 2002 Sep;46(9):2948-55. [PubMed:12183252] |
(8) Burrus V, Waldor MK. (2003) Control of SXT integration and excision. J Bacteriol. 2003 Sep;185(17):5045-54. [PubMed:12923077] |
(9) Beaber JW, Hochhut B, Waldor MK. (2004) SOS response promotes horizontal dissemination of antibiotic resistance genes. Nature. 2004 Jan 1;427(6969):72-4. [PubMed:14688795] |
(10) Bresolin NL, Essig LC, Kleis RL. (1996) [Renal vein thrombosis in newborn infants]. J Pediatr (Rio J). 1996 Jan-Feb;72(1):44-8. [PubMed:14688975] |
(11) Böltner D, Osborn AM. (2004) Structural comparison of the integrative and conjugative elements R391, pMERPH, R997, and SXT. Plasmid. 2004 Jan;51(1):12-23. [PubMed:14711525] |
(12) Burrus V, Waldor MK. (2004) Formation of SXT tandem arrays and SXT-R391 hybrids. J Bacteriol. 2004 May;186(9):2636-45. [PubMed:15090504] |
(13) Beaber JW, Waldor MK. (2004) Identification of operators and promoters that control SXT conjugative transfer. J Bacteriol. 2004 Sep;186(17):5945-9. [PubMed:15317801] |
(14) Marrero J, Waldor MK. (2005) Interactions between inner membrane proteins in donor and recipient cells limit conjugal DNA transfer. Dev Cell. 2005 Jun;8(6):963-70. [PubMed:15935784] |
(15) McLeod SM, Burrus V, Waldor MK. (2006) Requirement for Vibrio cholerae integration host factor in conjugative DNA transfer. J Bacteriol. 2006 Aug;188(16):5704-11. [PubMed:16885438] |
(16) Marrero J, Waldor MK. (2007) The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 2007 Apr;189(8):3302-5. [PubMed:17307849] |
(17) Ceccarelli D, Daccord A, René M, Burrus V. (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 2008 Aug;190(15):5328-38. [PubMed:18539733] |
(18) Wozniak RA, Waldor MK. (2009) A toxin-antitoxin system promotes the maintenance of an integrative conjugative element. PLoS Genet. 2009 Mar;5(3):e1000439. [PubMed:19325886] |
(19) Bordeleau E, Brouillette E, Robichaud N, Burrus V. (2010) Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 2010 Feb;12(2):510-23. [PubMed:19888998] |
(20) Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli D, Garriss G, Déry C, Burrus V, Waldor MK. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 2009 Dec;5(12):e1000786. [PubMed:20041216] |
(21) Chen WY, Ho JW, Huang JD, Watt RM. (2011) Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae. BMC Mol Biol. 2011 Apr 18;12:16. [PubMed:21501469] |