Information of ICE
| ICEberg ID | 36 |
|---|---|
| ICE Name | ICEVflInd1 |
| ICEO ID | ICEO_0000013 |
| Organism | Vibrio fluvialis Ind1 |
| Size | 114195 bp |
| GC Content (%) | 47.59 |
| Insertion site | prfC |
| Function | R Aminoglycoside, Folate pathway antagonist, Phenicol, Sulphonamide |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | GQ463144 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..114195 |
| Putative oriT region | coordinates: 21141..21247; oriTDB id: 200056 TCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGC CAAACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA |
| Putative relaxase | - |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICEVflInd1 components from GQ463144
Complete gene list of ICEVflInd1 from GQ463144
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The Interaction Network among ICE/IME/CIME
Detailed Informatioin of the Interaction Network
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
|---|---|---|---|---|---|---|
| 1 | ICEVflInd1 | MGIVflInd1 [IME] |  in trans | Vibrio fluvialis; E. coli CAG18439 | Escherichia coli | 20807202;23204461 |
| (1) Marrero J, Waldor MK. (2007) The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 2007 Apr;189(8):3302-5. [PubMed:17307849] |
| (2) Bordeleau E, Brouillette E, Robichaud N, Burrus V. (2010) Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 2010 Feb;12(2):510-23. [PubMed:19888998] |
| (3) Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli D, Garriss G, Déry C, Burrus V, Waldor MK. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 2009 Dec;5(12):e1000786. [PubMed:20041216] |
| (4) Daccord A, Ceccarelli D, Burrus V. (2010) Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 2010 Nov;78(3):576-88. [PubMed:20807202] |