Information of ICE
| ICEberg ID | 79 |
|---|---|
| ICE Name | ICESt3 |
| ICEO ID | ICEO_0000119 |
| Organism | Streptococcus thermophilus CNRZ385 |
| Size | 28090 bp |
| GC Content (%) | 36.9 |
| Insertion site | fda |
| Function | D Restriction-Modification |
| Species that ICE can be transferred to | Streptococcus pyogenes; Enterococcus faecalis |
| Nucleotide Sequence | AJ586568 (complete ICE sequence in this GenBank file) |
| Coordinates | 204..28293 |
| Putative oriT region | coordinates: 16700..16912; oriTDB id: 200003 CTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAA CCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCAT TCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGT GTCACTTAGTCAAAAGGAGGTGTTCCCATGA |
| Putative relaxase | coordinates: 17116..18348; Family: MOBT |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICESt3 components from AJ586568
Complete gene list of ICESt3 from AJ586568
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The Interaction Network among ICE/IME/CIME

Detailed Informatioin of the Interaction Network
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
|---|---|---|---|---|---|---|
| 1 | ICESt3 | IME_GB00957_oriT [IME] | | - | - | - |
| 2 | ICESt3 | CIME19258 [CIME] | | - | - | - |
| 3 | ICESt3 | CIME9 [CIME] | | - | - | - |
| 4 | ICESt3 | CIMEL3catR3 [CIME] | | Streptococcus thermophilus | Streptococcus thermophilus | 21722203 |
| (1) Pavlovic G, Burrus V, Gintz B, Decaris B, Guédon G. (2004) Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology (Reading). 2004 Apr;150(Pt 4):759-774. [PubMed:15073287] |
| (2) Bellanger X, Morel C, Decaris B, Guédon G. (2007) Derepression of excision of integrative and potentially conjugative elements from Streptococcus thermophilus by DNA damage response: implication of a cI-related repressor. J Bacteriol. 2007 Feb;189(4):1478-81. [PubMed:17114247] |
| (3) Bellanger X, Morel C, Decaris B, Guédon G. (2008) Regulation of excision of integrative and potentially conjugative elements from Streptococcus thermophilus: role of the arp1 repressor. J Mol Microbiol Biotechnol. 2008;14(1-3):16-21. [PubMed:17957106] |
| (4) Bringel F, Vuilleumier S, Arsène-Ploetze F. (2008) Low carbamoyl phosphate pools may drive Lactobacillus plantarum CO2-dependent growth phenotype. J Mol Microbiol Biotechnol. 2008;14(1-3):22-30. [PubMed:17957107] |
| (5) Bellanger X, Roberts AP, Morel C, Choulet F, Pavlovic G, Mullany P, Decaris B, Guédon G. (2009) Conjugative transfer of the integrative conjugative elements ICESt1 and ICESt3 from Streptococcus thermophilus. J Bacteriol. 2009 Apr;191(8):2764-75. [PubMed:19181800] |
| (6) Libante V, Sarica N, Mohamad Ali A, Gapp C, Oussalah A, Guédon G, Leblond-Bourget N, Payot S (2020) Mobilization of IMEs Integrated in the oriT of ICEs Involves Their Own Relaxase Belonging to the Rep-Trans Family of Proteins. Genes (Basel). 2020 Aug 26;11(9):1004. [PubMed:32859088] |