Information of ICE
| ICEberg ID | 45 |
|---|---|
| ICE Name | Tn916 |
| ICEO ID | ICEO_0000358 |
| Organism | Enterococcus faecalis DS16 |
| Size | 18032 bp |
| GC Content (%) | 38.75 |
| Insertion site | AT rich regions |
| Function | R Tetracycline |
| Species that ICE can be transferred to | Enterococcus faecalis; Butyrivibrio proteoclasticus; Streptococcus spp.; Lactococcus lactis; Lactobacillus paracasei; Neisseria sp.; Escherichia coli; Desulfitobacterium dehalogenans; Bacillus subtilis; Bacillus thuringiensis subsp. Israelensis |
| Nucleotide Sequence | U09422 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..18032 |
| Putative oriT region | coordinates: 2501..2633; oriTDB id: 200001 TTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTA GAAAATCCTTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAA AGTTGACATAC |
| Putative relaxase | coordinates: 2861..3850; Family: MOBT |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of Tn916 components from U09422
Complete gene list of Tn916 from U09422
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The Interaction Network among ICE/IME/CIME
Detailed Informatioin of the Interaction Network
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
|---|---|---|---|---|---|---|
| 1 | Tn916 | IME_GB00957_oriT [IME] |  in trans | - | - | - |
| 2 | Tn916 | MTnSag1 [tISSag10] [IME] |  in trans | Streptococcus agalactiae UCN36 | Streptococcus agalactiae BM134; Streptococcus agalactiae BM132 | 17416666 |
| 3 | Tn916 | tISCpe8 [IME] | in trans | Clostridium perfringens JIR4225 | Clostridium perfringens JIR4394 | 19684139 |
| (1) Su YA, He P, Clewell DB. (1992) Characterization of the tet(M) determinant of Tn916: evidence for regulation by transcription attenuation. Antimicrob Agents Chemother. 1992 Apr;36(4):769-78. [PubMed:1323953] |
| (2) Mullany P, Wilks M, Tabaqchali S. (1991) Transfer of Tn916 and Tn916 delta E into Clostridium difficile: demonstration of a hot-spot for these elements in the C. difficile genome. FEMS Microbiol Lett. 1991 Apr 15;63(2-3):191-4. [PubMed:1647998] |
| (3) Storrs MJ, Poyart-Salmeron C, Trieu-Cuot P, Courvalin P. (1991) Conjugative transposition of Tn916 requires the excisive and integrative activities of the transposon-encoded integrase. J Bacteriol. 1991 Jul;173(14):4347-52. [PubMed:1648556] |
| (4) Stephens DS, Swartley JS, Kathariou S, Morse SA. (1991) Insertion of Tn916 in Neisseria meningitidis resulting in loss of group B capsular polysaccharide. Infect Immun. 1991 Nov;59(11):4097-102. [PubMed:1657783] |
| (5) Flannagan SE, Clewell DB. (1991) Conjugative transfer of Tn916 in Enterococcus faecalis: trans activation of homologous transposons. J Bacteriol. 1991 Nov;173(22):7136-41. [PubMed:1657880] |
| (6) Norgren M, Scott JR. (1991) The presence of conjugative transposon Tn916 in the recipient strain does not impede transfer of a second copy of the element. J Bacteriol. 1991 Jan;173(1):319-24. [PubMed:1846138] |
| (7) Bertram J, Strätz M, Dürre P. (1991) Natural transfer of conjugative transposon Tn916 between gram-positive and gram-negative bacteria. J Bacteriol. 1991 Jan;173(2):443-8. [PubMed:1846142] |
| (8) Kathariou S, Stephens DS, Spellman P, Morse SA. (1990) Transposition of Tn916 to different sites in the chromosome of Neisseria meningitidis: a genetic tool for meningococcal mutagenesis. Mol Microbiol. 1990 May;4(5):729-35. [PubMed:2167422] |
| (9) Caparon MG, Scott JR. (1989) Excision and insertion of the conjugative transposon Tn916 involves a novel recombination mechanism. Cell. 1989 Dec 22;59(6):1027-34. [PubMed:2557157] |
| (10) Senghas E, Jones JM, Yamamoto M, Gawron-Burke C, Clewell DB. (1988) Genetic organization of the bacterial conjugative transposon Tn916. J Bacteriol. 1988 Jan;170(1):245-9. [PubMed:2826394] |
| (11) Clewell DB, Flannagan SE, Ike Y, Jones JM, Gawron-Burke C. (1988) Sequence analysis of termini of conjugative transposon Tn916. J Bacteriol. 1988 Jul;170(7):3046-52. [PubMed:2838457] |
| (12) Scott JR, Kirchman PA, Caparon MG. (1988) An intermediate in transposition of the conjugative transposon Tn916. Proc Natl Acad Sci U S A. 1988 Jul;85(13):4809-13. [PubMed:2838847] |
| (13) Franke AE, Clewell DB. (1981) Evidence for a chromosome-borne resistance transposon (Tn916) in Streptococcus faecalis that is capable of "conjugal" transfer in the absence of a conjugative plasmid. J Bacteriol. 1981 Jan;145(1):494-502. [PubMed:6257641] |
| (14) Hartley DL, Jones KR, Tobian JA, LeBlanc DJ, Macrina FL. (1984) Disseminated tetracycline resistance in oral streptococci: implication of a conjugative transposon. Infect Immun. 1984 Jul;45(1):13-7. [PubMed:6329954] |
| (15) Manganelli R, Romano L, Ricci S, Zazzi M, Pozzi G. (1995) Dosage of Tn916 circular intermediates in Enterococcus faecalis. Plasmid. 1995 Jul;34(1):48-57. [PubMed:7480170] |
| (16) Jaworski DD, Clewell DB. (1995) A functional origin of transfer (oriT) on the conjugative transposon Tn916. J Bacteriol. 1995 Nov;177(22):6644-51. [PubMed:7592445] |
| (17) Lu F, Churchward G. (1995) Tn916 target DNA sequences bind the C-terminal domain of integrase protein with different affinities that correlate with transposon insertion frequency. J Bacteriol. 1995 Apr;177(8):1938-46. [PubMed:7721684] |
| (18) Flannagan SE, Zitzow LA, Su YA, Clewell DB. (1994) Nucleotide sequence of the 18-kb conjugative transposon Tn916 from Enterococcus faecalis. Plasmid. 1994 Nov;32(3):350-4. [PubMed:7899523] |
| (19) Lu F, Churchward G. (1994) Conjugative transposition: Tn916 integrase contains two independent DNA binding domains that recognize different DNA sequences. EMBO J. 1994 Apr 1;13(7):1541-8. [PubMed:8156992] |
| (20) Jaworski DD, Clewell DB. (1994) Evidence that coupling sequences play a frequency-determining role in conjugative transposition of Tn916 in Enterococcus faecalis. J Bacteriol. 1994 Jun;176(11):3328-35. [PubMed:8195088] |
| (21) Su YA, Clewell DB. (1993) Characterization of the left 4 kb of conjugative transposon Tn916: determinants involved in excision. Plasmid. 1993 Nov;30(3):234-50. [PubMed:8302931] |
| (22) Clewell DB, Jaworski DD, Flannagan SE, Zitzow LA, Su YA. (1995) The conjugative transposon Tn916 of Enterococcus faecalis: structural analysis and some key factors involved in movement. Dev Biol Stand. 1995;85:11-7. [PubMed:8586160] |
| (23) Showsh SA, Andrews RE Jr. (1996) Functional comparison of conjugative transposons Tn916 and Tn925. Plasmid. 1996 May;35(3):164-73. [PubMed:8812783] |
| (24) Manganelli R, Ricci S, Pozzi G. (1996) Conjugative transposon Tn916: evidence for excision with formation of 5'-protruding termini. J Bacteriol. 1996 Oct;178(19):5813-6. [PubMed:8824634] |
| (25) Jaworski DD, Flannagan SE, Clewell DB. (1996) Analyses of traA, int-Tn, and xis-Tn mutations in the conjugative transposon Tn916 in Enterococcus faecalis. Plasmid. 1996 Nov;36(3):201-8. [PubMed:9007015] |
| (26) Taylor KL, Churchward G. (1997) Specific DNA cleavage mediated by the integrase of conjugative transposon Tn916. J Bacteriol. 1997 Feb;179(4):1117-25. [PubMed:9023193] |
| (27) Rudy CK, Scott JR, Churchward G. (1997) DNA binding by the Xis protein of the conjugative transposon Tn916. J Bacteriol. 1997 Apr;179(8):2567-72. [PubMed:9098054] |
| (28) Celli J, Poyart C, Trieu-Cuot P. (1997) Use of an excision reporter plasmid to study the intracellular mobility of the conjugative transposon Tn916 in gram-positive bacteria. Microbiology (Reading). 1997 Apr;143 ( Pt 4):1253-1261. [PubMed:9141688] |
| (29) Rudy C, Taylor KL, Hinerfeld D, Scott JR, Churchward G. (1997) Excision of a conjugative transposon in vitro by the Int and Xis proteins of Tn916. Nucleic Acids Res. 1997 Oct 15;25(20):4061-6. [PubMed:9321658] |
| (30) Manganelli R, Ricci S, Pozzi G. (1997) The joint of Tn916 circular intermediates is a homoduplex in Enterococcus faecalis. Plasmid. 1997;38(2):71-8. [PubMed:9339464] |
| (31) Celli J, Trieu-Cuot P. (1998) Circularization of Tn916 is required for expression of the transposon-encoded transfer functions: characterization of long tetracycline-inducible transcripts reading through the attachment site. Mol Microbiol. 1998 Apr;28(1):103-17. [PubMed:9593300] |
| (32) Connolly KM, Wojciak JM, Clubb RT. (1998) Site-specific DNA binding using a variation of the double stranded RNA binding motif. Nat Struct Biol. 1998 Jul;5(7):546-50. [PubMed:9665166] |
| (33) Nelson KE, Richardson DL, Dougherty BA. (1997) Tn916 transposition in Haemophilus influenzae Rd: preferential insertion into noncoding DNA. Microb Comp Genomics. 1997;2(4):313-21. [PubMed:9689229] |
| (34) Marra D, Scott JR. (1999) Regulation of excision of the conjugative transposon Tn916. Mol Microbiol. 1999 Jan;31(2):609-21. [PubMed:10027977] |
| (35) Wojciak JM, Connolly KM, Clubb RT. (1999) NMR structure of the Tn916 integrase-DNA complex. Nat Struct Biol. 1999 Apr;6(4):366-73. [PubMed:10201406] |
| (36) O'Keeffe T, Hill C, Ross RP. (1999) In situ inversion of the conjugative transposon Tn916 in Enterococcus faecium DPC3675. FEMS Microbiol Lett. 1999 Apr 1;173(1):265-71. [PubMed:10220904] |
| (37) Marra D, Smith JG, Scott JR. (1999) Excision of the conjugative transposon Tn916 in Lactococcus lactis. Appl Environ Microbiol. 1999 May;65(5):2230-1. [PubMed:10224024] |
| (38) Waters VL. (1999) Conjugative transfer in the dissemination of beta-lactam and aminoglycoside resistance. Front Biosci. 1999 May 1;4:D433-56. [PubMed:10228095] |
| (39) Jia Y, Churchward G. (1999) Interactions of the integrase protein of the conjugative transposon Tn916 with its specific DNA binding sites. J Bacteriol. 1999 Oct;181(19):6114-23. [PubMed:10498726] |
| (40) Smidt H, Song D, van Der Oost J, de Vos WM. (1999) Random transposition by Tn916 in Desulfitobacterium dehalogenans allows for isolation and characterization of halorespiration-deficient mutants. J Bacteriol. 1999 Nov;181(22):6882-8. [PubMed:10559152] |
| (41) Pethel B, Churchward G. (2000) Coupling sequences flanking Tn916 do not determine the affinity of binding of integrase to the transposon ends and adjacent bacterial DNA. Plasmid. 2000 Mar;43(2):123-9. [PubMed:10686130] |
| (42) Wang H, Roberts AP, Mullany P. (2000) DNA sequence of the insertional hot spot of Tn916 in the Clostridium difficile genome and discovery of a Tn916-like element in an environmental isolate integrated in the same hot spot. FEMS Microbiol Lett. 2000 Nov 1;192(1):15-20. [PubMed:11040422] |
| (43) Hinerfeld D, Churchward G. (2001) Specific binding of integrase to the origin of transfer (oriT) of the conjugative transposon Tn916. J Bacteriol. 2001 May;183(9):2947-51. [PubMed:11292817] |
| (44) Hinerfeld D, Churchward G. (2001) Xis protein of the conjugative transposon Tn916 plays dual opposing roles in transposon excision. Mol Microbiol. 2001 Sep;41(6):1459-67. [PubMed:11580848] |
| (45) Connolly KM, Iwahara M, Clubb RT. (2002) Xis protein binding to the left arm stimulates excision of conjugative transposon Tn916. J Bacteriol. 2002 Apr;184(8):2088-99. [PubMed:11914339] |
| (46) Taraskina AE, Savicheva AM, Akopian TA, Soroka AE, Momynaliev KT, Govorun VM. (2002) Drift of tetM determinant in urogenital microbiocenosis containing mycoplasmas during treatment with a tetracycline antibiotic. Bull Exp Biol Med. 2002 Jul;134(1):60-3. [PubMed:12459871] |
| (47) Roberts AP, Hennequin C, Elmore M, Collignon A, Karjalainen T, Minton N, Mullany P. (2003) Development of an integrative vector for the expression of antisense RNA in Clostridium difficile. J Microbiol Methods. 2003 Dec;55(3):617-24. [PubMed:14607405] |
| (48) Bahl MI, Sørensen SJ, Hansen LH, Licht TR. (2004) Effect of tetracycline on transfer and establishment of the tetracycline-inducible conjugative transposon Tn916 in the guts of gnotobiotic rats. Appl Environ Microbiol. 2004 Feb;70(2):758-64. [PubMed:14766552] |
| (49) Huys G, D'Haene K, Collard JM, Swings J. (2004) Prevalence and molecular characterization of tetracycline resistance in Enterococcus isolates from food. Appl Environ Microbiol. 2004 Mar;70(3):1555-62. [PubMed:15006778] |
| (50) Gorfe AA, Caflisch A, Jelesarov I. (2004) The role of flexibility and hydration on the sequence-specific DNA recognition by the Tn916 integrase protein: a molecular dynamics analysis. J Mol Recognit. 2004 Mar-Apr;17(2):120-31. [PubMed:15027032] |
| (51) Hussain HA, Roberts AP, Mullany P. (2005) Generation of an erythromycin-sensitive derivative of Clostridium difficile strain 630 (630Deltaerm) and demonstration that the conjugative transposon Tn916DeltaE enters the genome of this strain at multiple sites. J Med Microbiol. 2005 Feb;54(Pt 2):137-141. [PubMed:15673506] |
| (52) Abbani M, Iwahara M, Clubb RT. (2005) The structure of the excisionase (Xis) protein from conjugative transposon Tn916 provides insights into the regulation of heterobivalent tyrosine recombinases. J Mol Biol. 2005 Mar 18;347(1):11-25. [PubMed:15733914] |
| (53) Rocco JM, Churchward G. (2006) The integrase of the conjugative transposon Tn916 directs strand- and sequence-specific cleavage of the origin of conjugal transfer, oriT, by the endonuclease Orf20. J Bacteriol. 2006 Mar;188(6):2207-13. [PubMed:16513750] |
| (54) Rossi-Fedele G, Scott W, Spratt D, Gulabivala K, Roberts AP. (2006) Incidence and behaviour of Tn916-like elements within tetracycline-resistant bacteria isolated from root canals. Oral Microbiol Immunol. 2006 Aug;21(4):218-22. [PubMed:16842505] |
| (55) Rice LB, Carias LL, Hutton-Thomas R, Rudin S. (2007) Interaction of related Tn916-like transposons: analysis of excision events promoted by Tn916 and Tn5386 integrases. J Bacteriol. 2007 May;189(10):3909-17. [PubMed:17322310] |
| (56) Rossi-Fedele G, Roberts AP. (2007) A preliminary study investigating the survival of tetracycline resistant Enterococcus faecalis after root canal irrigation with high concentrations of tetracycline. Int Endod J. 2007 Oct;40(10):772-7. [PubMed:17697106] |
| (57) Flórez AB, Ammor MS, Mayo B. (2008) Identification of tet(M) in two Lactococcus lactis strains isolated from a Spanish traditional starter-free cheese made of raw milk and conjugative transfer of tetracycline resistance to lactococci and enterococci. Int J Food Microbiol. 2008 Jan 31;121(2):189-94. [PubMed:18068255] |
| (58) Ye C, Bai X, Zhang J, Jing H, Zheng H, Du H, Cui Z, Zhang S, Jin D, Xu Y, Xiong Y, Zhao A, Luo X, Sun Q, Gottschalk M, Xu J. (2008) Spread of Streptococcus suis sequence type 7, China. Emerg Infect Dis. 2008 May;14(5):787-91. [PubMed:18439362] |
| (59) Serfiotis-Mitsa D, Roberts GA, Cooper LP, White JH, Nutley M, Cooper A, Blakely GW, Dryden DT. (2008) The Orf18 gene product from conjugative transposon Tn916 is an ArdA antirestriction protein that inhibits type I DNA restriction-modification systems. J Mol Biol. 2008 Nov 28;383(5):970-81. [PubMed:18838147] |
| (60) Devirgiliis C, Coppola D, Barile S, Colonna B, Perozzi G. (2009) Characterization of the Tn916 conjugative transposon in a food-borne strain of Lactobacillus paracasei. Appl Environ Microbiol. 2009 Jun;75(12):3866-71. [PubMed:19395574] |
| (61) Boguslawska J, Zycka-Krzesinska J, Wilcks A, Bardowski J. (2009) Intra- and interspecies conjugal transfer of Tn916-like elements from Lactococcus lactis in vitro and in vivo. Appl Environ Microbiol. 2009 Oct;75(19):6352-60. [PubMed:19666731] |
| (62) Hannan S, Ready D, Jasni AS, Rogers M, Pratten J, Roberts AP. (2010) Transfer of antibiotic resistance by transformation with eDNA within oral biofilms. FEMS Immunol Med Microbiol. 2010 Aug;59(3):345-9. [PubMed:20337719] |
| (63) Haenni M, Saras E, Bertin S, Leblond P, Madec JY, Payot S. (2010) Diversity and mobility of integrative and conjugative elements in bovine isolates of Streptococcus agalactiae, S. dysgalactiae subsp. dysgalactiae, and S. uberis. Appl Environ Microbiol. 2010 Dec;76(24):7957-65. [PubMed:20952646] |
| (64) Cookson AL, Noel S, Hussein H, Perry R, Sang C, Moon CD, Leahy SC, Altermann E, Kelly WJ, Attwood GT. (2011) Transposition of Tn916 in the four replicons of the Butyrivibrio proteoclasticus B316(T) genome. FEMS Microbiol Lett. 2011 Mar;316(2):144-51. [PubMed:21204937] |