Information of ICE
| ICEberg ID | 239_IME |
|---|---|
| ICE Name | Tn4399 |
| ICEO ID | - |
| Organism | Bacteroides fragilis TM4.2321 |
| Size | 2854 bp |
| GC Content (%) | - |
| Insertion site | Numerous sites |
| Function | - |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | L20975 (partial IME sequence) |
| Coordinates | 1..2854 |
| Putative oriT region | coordinates: 991..1189; oriTDB id: 200009 TTCGGCATCTAAGCCGTAAATCACATCTTTTTTAGGATAGCAAGTTAATGTCGGCGTATT ACATTCCCCGACCACTTGCCCCTCAAAAAGATGAGGGGAACGGCTCCCGATGGTCACGGA CTTTTCAGATTACATCAATCGGATTATTCACTAAAAAACAGATAGAACAGATGAAGAAAA ACAACATAATCACCTTA |
| Putative relaxase | coordinates: 1461..2417; Family: MOBP |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of Tn4399 components from L20975
Complete gene list of Tn4399 from L20975
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The Interaction Network among ICE/IME/CIME

Detailed Informatioin of the Interaction Network
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
|---|---|---|---|---|---|---|
| 1 | Tn4399 | CTnDOT [ICE] | | Bacteroides | Bacteroides | 8397185 |
| 2 | Tn4399 | pRK231 [IncP plasmid] | | Escherichia coli | Escherichia coli | 8397185 |
| 3 | Tn4399 | RP4 [IncP plasmid] | | Escherichia coli | Escherichia coli | 8397185 |
| 4 | Tn4399 | R751 [IncP plasmid] | | Escherichia coli | Escherichia coli | 8397185 |
| 5 | Tn4399 | pGAT400ΔBglII [nonconjugal plasmid] | | Bacteroides fragilis | Escherichia coli; Bacteroides fragilis | 2544548 |
| (1) Bass KA, Hecht DW. (2002) Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 2002 Apr;184(7):1895-904. [PubMed:11889096] |
| (2) Hecht DW, Malamy MH. (1989) Tn4399, a conjugal mobilizing transposon of Bacteroides fragilis. J Bacteriol. 1989 Jul;171(7):3603-8. [PubMed:2544548] |
| (3) Hecht DW, Thompson JS, Malamy MH. (1989) Characterization of the termini and transposition products of Tn4399, a conjugal mobilizing transposon of Bacteroides fragilis. Proc Natl Acad Sci U S A. 1989 Jul;86(14):5340-4. [PubMed:2546154] |
| (4) Murphy CG, Malamy MH. (1995) Requirements for strand- and site-specific cleavage within the oriT region of Tn4399, a mobilizing transposon from Bacteroides fragilis. J Bacteriol. 1995 Jun;177(11):3158-65. [PubMed:7768814] |
| (5) Murphy CG, Malamy MH. (1993) Characterization of a "mobilization cassette" in transposon Tn4399 from Bacteroides fragilis. J Bacteriol. 1993 Sep;175(18):5814-23. [PubMed:8397185] |
| (6) Smith CJ, Parker AC. (1996) A gene product related to Tral is required for the mobilization of Bacteroides mobilizable transposons and plasmids. Mol Microbiol. 1996 May;20(4):741-50. [PubMed:8793871] |
| (7) Bellanger X, Payot S, Leblond-Bourget N, Guédon G. (2014) Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 2014 Jul;38(4):720-60. [PubMed:24372381] |
| (8) Guédon G, Libante V, Coluzzi C, Payot S, Leblond-Bourget N. (2017) The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 2017 Nov 22;8(11):337. [PubMed:29165361] |