Information of ICE
| ICEberg ID | 92 |
|---|---|
| ICE Name | Tn1549 |
| ICEO ID | ICEO_0000177 |
| Organism | Enterococcus faecalis BM4382 |
| Size | 33805 bp |
| GC Content (%) | 52.83 |
| Insertion site | - |
| Function | - |
| Species that ICE can be transferred to | Enterococcus faecalis; Enterococcus faecium; Clostridium symbiosum |
| Nucleotide Sequence | AF192329 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..33805 |
| Putative oriT region | coordinates: 22239..22266; oriTDB id: 200002 GAGTGGCTACACTCCCTATGCTTGCT |
| Putative relaxase | coordinates: 20529..21857; Family: MOBP |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of Tn1549 components from AF192329
Complete gene list of Tn1549 from AF192329
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of Tn1549 is not available.
| (1) Garnier F, Taourit S, Glaser P, Courvalin P, Galimand M. (2000) Characterization of transposon Tn1549, conferring VanB-type resistance in Enterococcus spp. Microbiology (Reading). 2000 Jun;146 ( Pt 6):1481-1489. [PubMed:10846226] |
| (2) Tsvetkova K, Marvaud JC, Lambert T. (2010) Analysis of the mobilization functions of the vancomycin resistance transposon Tn1549, a member of a new family of conjugative elements. J Bacteriol. 2010 Feb;192(3):702-13. [PubMed:19966009] |
| (3) Foucault ML, Depardieu F, Courvalin P, Grillot-Courvalin C. (2010) Inducible expression eliminates the fitness cost of vancomycin resistance in enterococci. Proc Natl Acad Sci U S A. 2010 Sep 28;107(39):16964-9. [PubMed:20833818] |