Information of ICE
| ICEberg ID | 78 |
|---|---|
| ICE Name | ICESt1 |
| ICEO ID | ICEO_0000118 |
| Organism | Streptococcus thermophilus CNRZ368 |
| Size | 34760 bp |
| GC Content (%) | 34.99 |
| Insertion site | fda |
| Function | D Dodola D Restriction-Modification |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | AJ278471 (complete ICE sequence in this GenBank file) |
| Coordinates | 1290..36049 |
| Putative oriT region | coordinates: 23370..23582; oriTDB id: 200004 CTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAAACTTCAA CCCCCGTTTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCAT TCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGT GTCACTTAGTCAAAAGGAGGTGTTCCCATGA |
| Putative relaxase | - |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICESt1 components from AJ278471
Complete gene list of ICESt1 from AJ278471
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICESt1 is not available.
| (1) Burrus V, Roussel Y, Decaris B, Guédon G. (2000) Characterization of a novel integrative element, ICESt1, in the lactic acid bacterium Streptococcus thermophilus. Appl Environ Microbiol. 2000 Apr;66(4):1749-53. [PubMed:10742276] |
| (2) Burrus V, Bontemps C, Decaris B, Guédon G. (2001) Characterization of a novel type II restriction-modification system, Sth368I, encoded by the integrative element ICESt1 of Streptococcus thermophilus CNRZ368. Appl Environ Microbiol. 2001 Apr;67(4):1522-8. [PubMed:11282600] |
| (3) Burrus V, Pavlovic G, Decaris B, Guédon G. (2002) The ICESt1 element of Streptococcus thermophilus belongs to a large family of integrative and conjugative elements that exchange modules and change their specificity of integration. Plasmid. 2002 Sep;48(2):77-97. [PubMed:12383726] |
| (4) Pavlovic G, Burrus V, Gintz B, Decaris B, Guédon G. (2004) Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology (Reading). 2004 Apr;150(Pt 4):759-774. [PubMed:15073287] |
| (5) Bellanger X, Morel C, Decaris B, Guédon G. (2007) Derepression of excision of integrative and potentially conjugative elements from Streptococcus thermophilus by DNA damage response: implication of a cI-related repressor. J Bacteriol. 2007 Feb;189(4):1478-81. [PubMed:17114247] |
| (6) Sánchez-Muñoz C, Sanz D, Zabala M. (2007) Anthropometric characteristics, body composition and somatotype of elite junior tennis players. Br J Sports Med. 2007 Nov;41(11):793-9. [PubMed:17957016] |
| (7) Bellanger X, Morel C, Decaris B, Guédon G. (2008) Regulation of excision of integrative and potentially conjugative elements from Streptococcus thermophilus: role of the arp1 repressor. J Mol Microbiol Biotechnol. 2008;14(1-3):16-21. [PubMed:17957106] |
| (8) Bellanger X, Roberts AP, Morel C, Choulet F, Pavlovic G, Mullany P, Decaris B, Guédon G. (2009) Conjugative transfer of the integrative conjugative elements ICESt1 and ICESt3 from Streptococcus thermophilus. J Bacteriol. 2009 Apr;191(8):2764-75. [PubMed:19181800] |