Information of ICE
| ICEberg ID | 59 |
|---|---|
| ICE Name | ICEBs1 |
| ICEO ID | ICEO_0000112 |
| Organism | Bacillus subtilis subsp. subtilis str. 168 |
| Size | 20510 bp |
| GC Content (%) | 35.7[43.51] |
| Insertion site | tRNA-Leu(BSU_tRNA_51) |
| Function | D SpbK |
| Species that ICE can be transferred to | Bacillus and Listeria species |
| Nucleotide Sequence | AL009126 (complete ICE sequence in this genome) |
| Coordinates | 529423..549932 |
| Putative oriT region | coordinates: 5368..5391; oriTDB id: 200006 CCCCCCACGCTAACAGGGGGGT |
| Putative relaxase | coordinates: 534773..535831; Family: MOBT |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICEBs1 components from AL009126
Complete gene list of ICEBs1 from AL009126
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICEBs1 is not available.
| (1) Auchtung JM, Lee CA, Monson RE, Lehman AP, Grossman AD. (2005) Regulation of a Bacillus subtilis mobile genetic element by intercellular signaling and the global DNA damage response. Proc Natl Acad Sci U S A. 2005 Aug 30;102(35):12554-9. [PubMed:16105942] |
| (2) Goranov AI, Kuester-Schoeck E, Wang JD, Grossman AD. (2006) Characterization of the global transcriptional responses to different types of DNA damage and disruption of replication in Bacillus subtilis. J Bacteriol. 2006 Aug;188(15):5595-605. [PubMed:16855250] |
| (3) Lee CA, Grossman AD. (2007) Identification of the origin of transfer (oriT) and DNA relaxase required for conjugation of the integrative and conjugative element ICEBs1 of Bacillus subtilis. J Bacteriol. 2007 Oct;189(20):7254-61. [PubMed:17693500] |
| (4) Lee CA, Auchtung JM, Monson RE, Grossman AD. (2007) Identification and characterization of int (integrase), xis (excisionase) and chromosomal attachment sites of the integrative and conjugative element ICEBs1 of Bacillus subtilis. Mol Microbiol. 2007 Dec;66(6):1356-69. [PubMed:18005101] |
| (5) Bose B, Auchtung JM, Lee CA, Grossman AD. (2008) A conserved anti-repressor controls horizontal gene transfer by proteolysis. Mol Microbiol. 2008 Nov;70(3):570-82. [PubMed:18761623] |
| (6) Berkmen MB, Lee CA, Loveday EK, Grossman AD. (2010) Polar positioning of a conjugation protein from the integrative and conjugative element ICEBs1 of Bacillus subtilis. J Bacteriol. 2010 Jan;192(1):38-45. [PubMed:19734305] |
| (7) Lee CA, Babic A, Grossman AD. (2010) Autonomous plasmid-like replication of a conjugative transposon. Mol Microbiol. 2010 Jan;75(2):268-79. [PubMed:19943900] |
| (8) Bose B, Grossman AD. (2011) Regulation of horizontal gene transfer in Bacillus subtilis by activation of a conserved site-specific protease. J Bacteriol. 2011 Jan;193(1):22-9. [PubMed:21036995] |
| (9) Smits WK, Grossman AD. (2010) The transcriptional regulator Rok binds A+T-rich DNA and is involved in repression of a mobile genetic element in Bacillus subtilis. PLoS Genet. 2010 Nov 11;6(11):e1001207. [PubMed:21085634] |
| (10) Babic A, Berkmen MB, Lee CA, Grossman AD. (2011) Efficient gene transfer in bacterial cell chains. mBio. 2011 Mar 15;2(2):e00027-11. [PubMed:21406598] |