Information of ICE
| ICEberg ID | 43 |
|---|---|
| ICE Name | R391 |
| ICEO ID | ICEO_0000016 |
| Organism | Providencia rettgeri |
| Size | 88532 bp |
| GC Content (%) | 46.48 |
| Insertion site | prfC |
| Function | R Kanamycin D Bacteriophage Exclusion M Metal resistance |
| Species that ICE can be transferred to | Escherichia coli; Bacteroides spp. |
| Nucleotide Sequence | AY090559 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..88532 |
| Putative oriT region | coordinates: 5604..5710; oriTDB id: 200057 TCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGC CAAACGGATAGTAGTTTTGGTTTTTGGGGTTAATTGGATGGGGAA |
| Putative relaxase | coordinates: 32341..34491; Family: MOBH |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of R391 components from AY090559
Complete gene list of R391 from AY090559
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of R391 is not available.
| (1) Peters SE, Hobman JL, Strike P, Ritchie DA. (1991) Novel mercury resistance determinants carried by IncJ plasmids pMERPH and R391. Mol Gen Genet. 1991 Aug;228(1-2):294-9. [PubMed:1886614] |
| (2) Murphy DB, Pembroke JT. (1995) Transfer of the IncJ plasmid R391 to recombination deficient Escherichia coli K12: evidence that R391 behaves as a conjugal transposon. FEMS Microbiol Lett. 1995 Dec 15;134(2-3):153-8. [PubMed:8586262] |
| (3) Murphy DB, Pembroke JT. (1999) Monitoring of chromosomal insertions of the IncJ elements R391 and R997 in Escherichia coli K-12. FEMS Microbiol Lett. 1999 May 15;174(2):355-61. [PubMed:10339829] |
| (4) Hochhut B, Beaber JW, Woodgate R, Waldor MK. (2001) Formation of chromosomal tandem arrays of the SXT element and R391, two conjugative chromosomally integrating elements that share an attachment site. J Bacteriol. 2001 Feb;183(4):1124-32. [PubMed:11157923] |
| (5) Böltner D, MacMahon C, Pembroke JT, Strike P, Osborn AM. (2002) R391: a conjugative integrating mosaic comprised of phage, plasmid, and transposon elements. J Bacteriol. 2002 Sep;184(18):5158-69. [PubMed:12193633] |
| (6) Böltner D, Osborn AM. (2004) Structural comparison of the integrative and conjugative elements R391, pMERPH, R997, and SXT. Plasmid. 2004 Jan;51(1):12-23. [PubMed:14711525] |
| (7) Sabater-Muñoz B, van Ham RC, Moya A, Silva FJ, Latorre A. (2004) Evolution of the leucine gene cluster in Buchnera aphidicola: insights from chromosomal versions of the cluster. J Bacteriol. 2004 May;186(9):2646-54. [PubMed:15090505] |
| (8) McGrath BM, Pembroke JT. (2004) Detailed analysis of the insertion site of the mobile elements R997, pMERPH, R392, R705 and R391 in E. coli K12. FEMS Microbiol Lett. 2004 Aug 1;237(1):19-26. [PubMed:15268933] |
| (9) McGrath BM, O'Halloran JA, Pembroke JT. (2005) Pre-exposure to UV irradiation increases the transfer frequency of the IncJ conjugative transposon-like elements R391, R392, R705, R706, R997 and pMERPH and is recA+ dependent. FEMS Microbiol Lett. 2005 Feb 15;243(2):461-5. [PubMed:15686850] |
| (10) Marrero J, Waldor MK. (2005) Interactions between inner membrane proteins in donor and recipient cells limit conjugal DNA transfer. Dev Cell. 2005 Jun;8(6):963-70. [PubMed:15935784] |
| (11) Mead S, Vaisman A, Valjavec-Gratian M, Karata K, Vandewiele D, Woodgate R. (2007) Characterization of polVR391: a Y-family polymerase encoded by rumA'B from the IncJ conjugative transposon, R391. Mol Microbiol. 2007 Feb;63(3):797-810. [PubMed:17302804] |
| (12) Marrero J, Waldor MK. (2007) The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 2007 Apr;189(8):3302-5. [PubMed:17307849] |
| (13) O'Halloran JA, McGrath BM, Pembroke JT. (2007) The orf4 gene of the enterobacterial ICE, R391, encodes a novel UV-inducible recombination directionality factor, Jef, involved in excision and transfer of the ICE. FEMS Microbiol Lett. 2007 Jul;272(1):99-105. [PubMed:17504243] |
| (14) Marrero J, Waldor MK. (2007) Determinants of entry exclusion within Eex and TraG are cytoplasmic. J Bacteriol. 2007 Sep;189(17):6469-73. [PubMed:17573467] |
| (15) Taviani E, Ceccarelli D, Lazaro N, Bani S, Cappuccinelli P, Colwell RR, Colombo MM. (2008) Environmental Vibrio spp., isolated in Mozambique, contain a polymorphic group of integrative conjugative elements and class 1 integrons. FEMS Microbiol Ecol. 2008 Apr;64(1):45-54. [PubMed:18318712] |
| (16) Ceccarelli D, Daccord A, René M, Burrus V. (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 2008 Aug;190(15):5328-38. [PubMed:18539733] |
| (17) Bordeleau E, Brouillette E, Robichaud N, Burrus V. (2010) Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 2010 Feb;12(2):510-23. [PubMed:19888998] |
| (18) Garriss G, Waldor MK, Burrus V. (2009) Mobile antibiotic resistance encoding elements promote their own diversity. PLoS Genet. 2009 Dec;5(12):e1000775. [PubMed:20019796] |
| (19) Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli D, Garriss G, Déry C, Burrus V, Waldor MK. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 2009 Dec;5(12):e1000786. [PubMed:20041216] |