Information of ICE
| ICEberg ID | 427 |
|---|---|
| ICE Name | Tn6086 |
| ICEO ID | - |
| Organism | Enterococcus faecium TC 6 |
| Size | 24468 bp |
| GC Content (%) | 35.13 |
| Insertion site | - |
| Function | D Abortive infection/Phage exclusion systems R Tetracycline |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | HM636636 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..24468 |
| Putative oriT region | coordinates: 7493..7515; oriTDB id: 200005 CCCCTCTATCTAACAGGGGGG |
| Putative relaxase | coordinates: 7643..8827; Family: MOBT |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of Tn6086 components from HM636636
Complete gene list of Tn6086 from HM636636
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of Tn6086 is not available.
The reference information of Tn6086 is not available.