Information of ICE
| ICEberg ID | 41 |
|---|---|
| ICE Name | ICEPmiJpn1 |
| ICEO ID | ICEO_0000596 |
| Organism | Proteus mirabilis TUM4660 |
| Size | - |
| GC Content (%) | - |
| Insertion site | prfC |
| Function | D Abortive infection/Phage exclusion systems D Bacteriophage Exclusion R Beta-lactam D Restriction-Modification |
| Species that ICE can be transferred to | Escherichia coli; Klebsiella pneumoniae; Salmonella enterica serovar Typhimurium; Citrobacter koseri |
| Nucleotide Sequence | AB525688; AB525230; AB525229; AB525228; AB525227; AB525226;AB525225 (partial ICE sequence) |
| Coordinates | 1..422 |
| Putative oriT region | coordinates: 5850..5956; oriTDB id: 200057 TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAA GCCAAACGGATAGTAGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA |
| Putative relaxase | - |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICEPmiJpn1 components from AB525230
Complete gene list of ICEPmiJpn1 from AB525230
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The graph information of ICEPmiJpn1 components from AB525230
Complete gene list of ICEPmiJpn1 from AB525230
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The graph information of ICEPmiJpn1 components from AB525230
Complete gene list of ICEPmiJpn1 from AB525230
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The graph information of ICEPmiJpn1 components from AB525230
Complete gene list of ICEPmiJpn1 from AB525230
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The graph information of ICEPmiJpn1 components from AB525230
Complete gene list of ICEPmiJpn1 from AB525230
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The graph information of ICEPmiJpn1 components from AB525230
Complete gene list of ICEPmiJpn1 from AB525230
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The graph information of ICEPmiJpn1 components from AB525230
Complete gene list of ICEPmiJpn1 from AB525230
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICEPmiJpn1 is not available.
| (1) Harada S, Ishii Y, Saga T, Tateda K, Yamaguchi K. (2010) Chromosomally encoded blaCMY-2 located on a novel SXT/R391-related integrating conjugative element in a Proteus mirabilis clinical isolate. Antimicrob Agents Chemother. 2010 Sep;54(9):3545-50. [PubMed:20566768] |