Information of ICE
| ICEberg ID | 40 |
|---|---|
| ICE Name | ICEPmiUSA1 |
| ICEO ID | ICEO_0000006 |
| Organism | Proteus mirabilis HI4320 |
| Size | 80632 bp |
| GC Content (%) | 46.73[38.9] |
| Insertion site | prfC (PMI2422) |
| Function | D Abortive infection/Phage exclusion systems D GABIJA D Restriction-Modification |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | AM942759 (complete ICE sequence in this genome) |
| Coordinates | 2649499..2730130 |
| Putative oriT region | coordinates: 77456..77562; oriTDB id: 200056 CCCCATCCAATTAACCCCAAAAGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACG CCAAACGTAAAACTGCCGTAACAATCACTGTTTGGCGTCTCGATA |
| Putative relaxase | coordinates: 2702478..2704628; Family: MOBH |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICEPmiUSA1 components from AM942759
Complete gene list of ICEPmiUSA1 from AM942759
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICEPmiUSA1 is not available.
| (1) Flannery EL, Mody L, Mobley HL. (2009) Identification of a modular pathogenicity island that is widespread among urease-producing uropathogens and shares features with a diverse group of mobile elements. Infect Immun. 2009 Nov;77(11):4887-94. [PubMed:19687197] |
| (2) Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli D, Garriss G, Déry C, Burrus V, Waldor MK. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 2009 Dec;5(12):e1000786. [PubMed:20041216] |
| (3) Flannery EL, Antczak SM, Mobley HL. (2011) Self-transmissibility of the integrative and conjugative element ICEPm1 between clinical isolates requires a functional integrase, relaxase, and type IV secretion system. J Bacteriol. 2011 Aug;193(16):4104-12. [PubMed:21665966] |