Information of ICE
| ICEberg ID | 39 |
|---|---|
| ICE Name | ICESpuPO1 |
| ICEO ID | ICEO_0000007 |
| Organism | Shewanella putrefaciens W3-18-1 |
| Size | 111191 bp |
| GC Content (%) | 48.28[44.63] |
| Insertion site | prfC (Sputw3181_1184) |
| Function | D CBASS M Metal resistance D Restriction-Modification |
| Species that ICE can be transferred to | Shewanella putrefaciens |
| Nucleotide Sequence | CP000503 (complete ICE sequence in this genome) |
| Coordinates | 1224492..1335682 |
| Putative oriT region | coordinates: 4600..4706; oriTDB id: 200056 TCGAGACGCCAAACAGTGATTGTGACGGTAGTTTTACGTTTGGCGTTTCGATCCAAAAGC CAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGGTGAGGAA |
| Putative relaxase | coordinates: 1248113..1250263; Family: MOBH |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICESpuPO1 components from CP000503
Complete gene list of ICESpuPO1 from CP000503
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICESpuPO1 is not available.
| (1) Pembroke JT, Piterina AV. (2006) A novel ICE in the genome of Shewanella putrefaciens W3-18-1: comparison with the SXT/R391 ICE-like elements. FEMS Microbiol Lett. 2006 Nov;264(1):80-8. [PubMed:17020552] |
| (2) Marrero J, Waldor MK. (2007) The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 2007 Apr;189(8):3302-5. [PubMed:17307849] |
| (3) Ceccarelli D, Daccord A, René M, Burrus V. (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 2008 Aug;190(15):5328-38. [PubMed:18539733] |
| (4) Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli D, Garriss G, Déry C, Burrus V, Waldor MK. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 2009 Dec;5(12):e1000786. [PubMed:20041216] |