Information of ICE
| ICEberg ID | 38 |
|---|---|
| ICE Name | ICEPdaSpa1 |
| ICEO ID | ICEO_0000015 |
| Organism | Photobacterium damselae subsp. piscicida PC554.2 |
| Size | 102985 bp |
| GC Content (%) | 46.34 |
| Insertion site | prfC |
| Function | D Abortive infection/Phage exclusion systems D Bacteriophage Exclusion D Mokosh R Tetracycline |
| Species that ICE can be transferred to | Escherichia coli |
| Nucleotide Sequence | AJ870986 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..102985 |
| Putative oriT region | coordinates: 3696..3802; oriTDB id: 200056 TCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGC CAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA |
| Putative relaxase | coordinates: 39300..41450; Family: MOBH |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICEPdaSpa1 components from AJ870986
Complete gene list of ICEPdaSpa1 from AJ870986
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICEPdaSpa1 is not available.
| (1) Juíz-Río S, Osorio CR, de Lorenzo V, Lemos ML. (2005) Subtractive hybridization reveals a high genetic diversity in the fish pathogen Photobacterium damselae subsp. piscicida: evidence of a SXT-like element. Microbiology (Reading). 2005 Aug;151(Pt 8):2659-2669. [PubMed:16079344] |
| (2) Marrero J, Waldor MK. (2007) The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 2007 Apr;189(8):3302-5. [PubMed:17307849] |
| (3) Osorio CR, Marrero J, Wozniak RA, Lemos ML, Burrus V, Waldor MK. (2008) Genomic and functional analysis of ICEPdaSpa1, a fish-pathogen-derived SXT-related integrating conjugative element that can mobilize a virulence plasmid. J Bacteriol. 2008 May;190(9):3353-61. [PubMed:18326579] |
| (4) Ceccarelli D, Daccord A, René M, Burrus V. (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 2008 Aug;190(15):5328-38. [PubMed:18539733] |
| (5) Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli D, Garriss G, Déry C, Burrus V, Waldor MK. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 2009 Dec;5(12):e1000786. [PubMed:20041216] |