Information of ICE
| ICEberg ID | 341_IME |
|---|---|
| ICE Name | IME_Sga2069_rpmE |
| ICEO ID | - |
| Organism | Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069 |
| Size | 8559 bp |
| GC Content (%) | 32.89[37.65] |
| Insertion site | - |
| Function | - |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | NC_015215.1 (complete IME sequence in this GenBank file) |
| Coordinates | 737512..746070 |
| Putative oriT region | coordinates: 3259..3300; oriTDB id: 100158 TGTAAAGTGTAACGCACTACGCTTTACTTCGTAAAAGTGC |
| Putative relaxase | coordinates: 739401..740658; Family: MOBV |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of IME_Sga2069_rpmE components from NC_015215.1
Complete gene list of IME_Sga2069_rpmE from NC_015215.1
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of IME_Sga2069_rpmE is not available.
| (1) Guédon G, Lao J, Payot S, Lacroix T, Chiapello H, Leblond-Bourget N (2022) FirmiData: a set of 40 genomes of Firmicutes with a curated annotation of ICEs and IMEs. BMC Res Notes. 2022 May 10;15(1):157. [PubMed:35538580] |
| (2) Lao J, Lacroix T, Guédon G, Coluzzi C, Payot S, Leblond-Bourget N, Chiapello H. (2022) ICEscreen: a tool to detect Firmicute ICEs and IMEs, isolated or enclosed in composite structures. NAR Genom Bioinform. 2022 Oct 21;4(4):lqac079. [PubMed:36285285] |