Information of ICE
| ICEberg ID | 330_IME |
|---|---|
| ICE Name | IME_RhoA2-183_NS_2 |
| ICEO ID | - |
| Organism | Roseburia hominis A2-183 |
| Size | 7626 bp |
| GC Content (%) | 50.26[48.5] |
| Insertion site | - |
| Function | - |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | NC_015977.1 (complete IME sequence in this GenBank file) |
| Coordinates | 2395810..2403435 |
| Putative oriT region | coordinates: 136..170; oriTDB id: 100185 CGACTTTGCGGAGCAAAGTGTAGTGTGTTATAC |
| Putative relaxase | coordinates: 2400629..2401574; Family: MOBV |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of IME_RhoA2-183_NS_2 components from NC_015977.1
Complete gene list of IME_RhoA2-183_NS_2 from NC_015977.1
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of IME_RhoA2-183_NS_2 is not available.
| (1) Guédon G, Lao J, Payot S, Lacroix T, Chiapello H, Leblond-Bourget N (2022) FirmiData: a set of 40 genomes of Firmicutes with a curated annotation of ICEs and IMEs. BMC Res Notes. 2022 May 10;15(1):157. [PubMed:35538580] |
| (2) Lao J, Lacroix T, Guédon G, Coluzzi C, Payot S, Leblond-Bourget N, Chiapello H. (2022) ICEscreen: a tool to detect Firmicute ICEs and IMEs, isolated or enclosed in composite structures. NAR Genom Bioinform. 2022 Oct 21;4(4):lqac079. [PubMed:36285285] |