Information of ICE
| ICEberg ID | 309 |
|---|---|
| ICE Name | ICESag2603VR-1 |
| ICEO ID | - |
| Organism | Streptococcus agalactiae 2603V/R |
| Size | 18031 bp |
| GC Content (%) | 38.71[35.65] |
| Insertion site | AT rich regions |
| Function | R Tetracycline |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | AE009948 (complete ICE sequence in this genome) |
| Coordinates | 923465..941495 |
| Putative oriT region | coordinates: 15399..15531; oriTDB id: 200001 ATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAA AGGATTTTCTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACG GGGGGTTAAGT |
| Putative relaxase | - |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICESag2603VR-1 components from AE009948
Complete gene list of ICESag2603VR-1 from AE009948
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICESag2603VR-1 is not available.
| (1) Tettelin H, Masignani V, Cieslewicz MJ, Eisen JA, Peterson S, Wessels MR, Paulsen IT, Nelson KE, Margarit I, Read TD, Madoff LC, Wolf AM, Beanan MJ, Brinkac LM, Daugherty SC, DeBoy RT, Durkin AS, Kolonay JF, Madupu R, Lewis MR, Radune D, Fedorova NB, Scanlan D, Khouri H, Mulligan S, Carty HA, Cline RT, Van Aken SE, Gill J, Scarselli M, Mora M, Iacobini ET, Brettoni C, Galli G, Mariani M, Vegni F, Maione D, Rinaudo D, Rappuoli R, Telford JL, Kasper DL, Grandi G, Fraser CM. (2002) Complete genome sequence and comparative genomic analysis of an emerging human pathogen, serotype V Streptococcus agalactiae. Proc Natl Acad Sci U S A. 2002 Sep 17;99(19):12391-6. [PubMed:12200547] |