Information of ICE
| ICEberg ID | 306 |
|---|---|
| ICE Name | Tn925 |
| ICEO ID | ICEO_0000258 |
| Organism | Enterococcus faecalis plasmid pCF10 |
| Size | 18032 bp |
| GC Content (%) | 38.73[36.1] |
| Insertion site | AT rich regions |
| Function | R Tetracycline |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | AY855841 (complete ICE sequence in this genome) |
| Coordinates | 40068..58099 |
| Putative oriT region | coordinates: 15400..15532; oriTDB id: 200001 ATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAA AGGATTTTCTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACG GGGGGTTAAGT |
| Putative relaxase | - |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of Tn925 components from AY855841
Complete gene list of Tn925 from AY855841
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of Tn925 is not available.
| (1) Guffanti AA, Quirk PG, Krulwich TA. (1991) Transfer of Tn925 and plasmids between Bacillus subtilis and alkaliphilic Bacillus firmus OF4 during Tn925-mediated conjugation. J Bacteriol. 1991 Mar;173(5):1686-9. [PubMed:1847906] |
| (2) Torres OR, Korman RZ, Zahler SA, Dunny GM. (1991) The conjugative transposon Tn925: enhancement of conjugal transfer by tetracycline in Enterococcus faecalis and mobilization of chromosomal genes in Bacillus subtilis and E. faecalis. Mol Gen Genet. 1991 Mar;225(3):395-400. [PubMed:1850085] |
| (3) Kao SM, Olmsted SB, Viksnins AS, Gallo JC, Dunny GM. (1991) Molecular and genetic analysis of a region of plasmid pCF10 containing positive control genes and structural genes encoding surface proteins involved in pheromone-inducible conjugation in Enterococcus faecalis. J Bacteriol. 1991 Dec;173(23):7650-64. [PubMed:1938961] |
| (4) Christie PJ, Korman RZ, Zahler SA, Adsit JC, Dunny GM. (1987) Two conjugation systems associated with Streptococcus faecalis plasmid pCF10: identification of a conjugative transposon that transfers between S. faecalis and Bacillus subtilis. J Bacteriol. 1987 Jun;169(6):2529-36. [PubMed:3034859] |
| (5) Nakayama J, Ruhfel RE, Dunny GM, Isogai A, Suzuki A. (1994) The prgQ gene of the Enterococcus faecalis tetracycline resistance plasmid pCF10 encodes a peptide inhibitor, iCF10. J Bacteriol. 1994 Dec;176(23):7405-8. [PubMed:7545961] |
| (6) Ruhfel RE, Manias DA, Dunny GM. (1993) Cloning and characterization of a region of the Enterococcus faecalis conjugative plasmid, pCF10, encoding a sex pheromone-binding function. J Bacteriol. 1993 Aug;175(16):5253-9. [PubMed:8349565] |
| (7) Ruhfel RE, Manias DA, Dunny GM. (1993) Cloning and characterization of a region of the Enterococcus faecalis conjugative plasmid, pCF10, encoding a sex pheromone-binding function. J Bacteriol. 1993 Aug;175(16):5253-9. [PubMed:8349565] |
| (8) Hedberg PJ, Leonard BA, Ruhfel RE, Dunny GM. (1996) Identification and characterization of the genes of Enterococcus faecalis plasmid pCF10 involved in replication and in negative control of pheromone-inducible conjugation. Plasmid. 1996 Jan;35(1):46-57. [PubMed:8693026] |
| (9) Hirt H, Manias DA, Bryan EM, Klein JR, Marklund JK, Staddon JH, Paustian ML, Kapur V, Dunny GM. (2005) Characterization of the pheromone response of the Enterococcus faecalis conjugative plasmid pCF10: complete sequence and comparative analysis of the transcriptional and phenotypic responses of pCF10-containing cells to pheromone induction. J Bacteriol. 2005 Feb;187(3):1044-54. [PubMed:15659682] |
| (10) Hirt H, Manias DA, Bryan EM, Klein JR, Marklund JK, Staddon JH, Paustian ML, Kapur V, Dunny GM. (2005) Characterization of the pheromone response of the Enterococcus faecalis conjugative plasmid pCF10: complete sequence and comparative analysis of the transcriptional and phenotypic responses of pCF10-containing cells to pheromone induction. J Bacteriol. 2005 Feb;187(3):1044-54. [PubMed:15659682] |