Information of ICE
| ICEberg ID | 250_IME |
|---|---|
| ICE Name | Tn6215 |
| ICEO ID | - |
| Organism | Clostridium difficile CD80 |
| Size | 13008 bp |
| GC Content (%) | 43.07 |
| Insertion site | - |
| Function | R Macrolide, Lincosamide, Streptogramin B |
| Species that ICE can be transferred to | Clostridium difficile strain CD062 |
| Nucleotide Sequence | KC166248 (complete IME sequence in this GenBank file) |
| Coordinates | 1..13008 |
| Putative oriT region | coordinates: 12809..12843; oriTDB id: 100185 ATAACACACTACACTTTGCTTCGCAAAGTCGTG |
| Putative relaxase | coordinates: 2005..2943; Family: MOBV |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of Tn6215 components from KC166248
Complete gene list of Tn6215 from KC166248
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of Tn6215 is not available.
| (1) Goh S, Hussain H, Chang BJ, Emmett W, Riley TV, Mullany P. (2013) Phage ϕC2 mediates transduction of Tn6215, encoding erythromycin resistance, between Clostridium difficile strains. mBio. 2013 Nov 19;4(6):e00840-13. [PubMed:24255122] |
| (2) Wasels F, Spigaglia P, Barbanti F, Monot M, Villa L, Dupuy B, Carattoli A, Mastrantonio P. (2015) Integration of erm(B)-containing elements through large chromosome fragment exchange in Clostridium difficile. Mob Genet Elements. 2015 Feb 3;5(1):12-16. [PubMed:26442177] |
| (3) Guédon G, Libante V, Coluzzi C, Payot S, Leblond-Bourget N. (2017) The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 2017 Nov 22;8(11):337. [PubMed:29165361] |