Information of ICE
| ICEberg ID | 23 |
|---|---|
| ICE Name | ICEVchMex1 |
| ICEO ID | ICEO_0000011 |
| Organism | Vibrio cholerae non O1-O139 Mex1 |
| Size | 83194 bp |
| GC Content (%) | 46.73 |
| Insertion site | prfC |
| Function | R Aminoglycoside D GABIJA D Gao D PrrC D Restriction-Modification |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | GQ463143 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..83194 |
| Putative oriT region | coordinates: 5686..5792; oriTDB id: 200056 TCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGC CAAACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA |
| Putative relaxase | coordinates: 19499..21649; Family: MOBH |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICEVchMex1 components from GQ463143
Complete gene list of ICEVchMex1 from GQ463143
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICEVchMex1 is not available.
| (1) Burrus V, Quezada-Calvillo R, Marrero J, Waldor MK. (2006) SXT-related integrating conjugative element in New World Vibrio cholerae. Appl Environ Microbiol. 2006 Apr;72(4):3054-7. [PubMed:16598018] |
| (2) Marrero J, Waldor MK. (2007) The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 2007 Apr;189(8):3302-5. [PubMed:17307849] |
| (3) Bordeleau E, Brouillette E, Robichaud N, Burrus V. (2010) Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 2010 Feb;12(2):510-23. [PubMed:19888998] |
| (4) Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli D, Garriss G, Déry C, Burrus V, Waldor MK. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 2009 Dec;5(12):e1000786. [PubMed:20041216] |