Information of ICE
| ICEberg ID | 22 |
|---|---|
| ICE Name | ICEVchInd5 [ICEVchHai1] |
| ICEO ID | ICEO_0000010 |
| Organism | Vibrio cholerae O1 Ind5 |
| Size | 97952 bp |
| GC Content (%) | 46.73 |
| Insertion site | prfC |
| Function | D Abortive infection/Phage exclusion systems R Aminoglycoside, Folate pathway antagonist, Phenicol, Sulphonamide D Bacteriophage Exclusion |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | GQ463142 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..97952 |
| Putative oriT region | coordinates: 5906..6012; oriTDB id: 200056 TCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGC CAAACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA |
| Putative relaxase | coordinates: 41932..44082; Family: MOBH |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICEVchInd5 [ICEVchHai1] components from GQ463142
Complete gene list of ICEVchInd5 [ICEVchHai1] from GQ463142
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICEVchInd5 [ICEVchHai1] is not available.
| (1) Bordeleau E, Brouillette E, Robichaud N, Burrus V. (2010) Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 2010 Feb;12(2):510-23. [PubMed:19888998] |
| (2) Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli D, Garriss G, Déry C, Burrus V, Waldor MK. (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 2009 Dec;5(12):e1000786. [PubMed:20041216] |
| (3) Ceccarelli D, Spagnoletti M, Bacciu D, Danin-Poleg Y, Mendiratta DK, Kashi Y, Cappuccinelli P, Burrus V, Colombo MM. (2011) ICEVchInd5 is prevalent in epidemic Vibrio cholerae O1 El Tor strains isolated in India. Int J Med Microbiol. 2011 Apr;301(4):318-24. [PubMed:21276749] |