Information of ICE
| ICEberg ID | 1905 |
|---|---|
| ICE Name | ICESsuYS388 |
| ICEO ID | - |
| Organism | S. suis YS388 |
| Size | 70013 bp |
| GC Content (%) | 38.66 |
| Insertion site | rplL |
| Function | R Aminoglycoside, Macrolide, Lincosamide, Streptogramin B, Tetracycline |
| Species that ICE can be transferred to | S. suis strain P1/7RIF |
| Nucleotide Sequence | MK211824.1 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..70013 |
| Putative oriT region | coordinates: 37889..37923; oriTDB id: 100185 ATAACACACTACACTTTGCTTCGCAAAGTCGTG |
| Putative relaxase | coordinates: 16707..18591; Family: MOBP1 |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICESsuYS388 components from MK211824.1
Complete gene list of ICESsuYS388 from MK211824.1
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICESsuYS388 is not available.
| (1) Wang J, Qi K, Bai X, Wu Z, Kang W, Liang P, Zheng H, Xu J (2022) Characterization of integrative and conjugative elements carrying antibiotic resistance genes of Streptococcus suis isolated in China. Front Microbiol. 2022 Dec 22;13:1074844. [PubMed:36620002] |