Information of ICE
| ICEberg ID | 1889 |
|---|---|
| ICE Name | ICESsuSC317 |
| ICEO ID | - |
| Organism | S. suis SC317 |
| Size | 106789 bp |
| GC Content (%) | 37.49 |
| Insertion site | rumA |
| Function | R Oxazolidinone, Phenicol, Tetracycline D Restriction-Modification |
| Species that ICE can be transferred to | S. suis BAA-853 |
| Nucleotide Sequence | MK359989.1 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..106789 |
| Putative oriT region | coordinates: 31681..31715; oriTDB id: 100185 ATAACACACTACACTTTGCTTCGCAAAGTCGTG |
| Putative relaxase | coordinates: 11433..13317; Family: MOBP1 |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICESsuSC317 components from MK359989.1
Complete gene list of ICESsuSC317 from MK359989.1
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICESsuSC317 is not available.
| (1) Shang Y, Li D, Hao W, Schwarz S, Shan X, Liu B, Zhang SM, Li XS, Du XD (2019) A prophage and two ICESa2603-family integrative and conjugative elements (ICEs) carrying optrA in Streptococcus suis. J Antimicrob Chemother. 2019 Oct 1;74(10):2876-2879. [PubMed:31314095] |