Information of ICE
| ICEberg ID | 176_IME |
|---|---|
| ICE Name | MGIVchMoz6 |
| ICEO ID | - |
| Organism | Vibrio cholerae 16AMOZ |
| Size | 18824 bp |
| GC Content (%) | - |
| Insertion site | 3′ end of yicC |
| Function | D Restriction-Modification |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | KC117175 (partial IME sequence) |
| Coordinates | 1..18824 |
| Putative oriT region | coordinates: 5288..5391; oriTDB id: 200056 CCCCATGCCTTTACCCCCTTACGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACG CCAAACAGGGAAATTAGCCCATTTACTGTTTGGCGTCTCGAT |
| Putative relaxase | - |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of MGIVchMoz6 components from KC117175
Complete gene list of MGIVchMoz6 from KC117175
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The Interaction Network among ICE/IME/CIME
Detailed Informatioin of the Interaction Network
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
|---|---|---|---|---|---|---|
| 1 | MGIVchMoz6 | ICEVchMoz6 [ICE] |  in trans | Vibrio cholerae | Escherichia coli | 23204461 |
| (1) Taviani E, Ceccarelli D, Lazaro N, Bani S, Cappuccinelli P, Colwell RR, Colombo MM. (2008) Environmental Vibrio spp., isolated in Mozambique, contain a polymorphic group of integrative conjugative elements and class 1 integrons. FEMS Microbiol Ecol. 2008 Apr;64(1):45-54. [PubMed:18318712] |
| (2) Daccord A, Ceccarelli D, Rodrigue S, Burrus V. (2013) Comparative analysis of mobilizable genomic islands. J Bacteriol. 2013 Feb;195(3):606-14. [PubMed:23204461] |
| (3) Guédon G, Libante V, Coluzzi C, Payot S, Leblond-Bourget N. (2017) The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 2017 Nov 22;8(11):337. [PubMed:29165361] |