Information of ICE
| ICEberg ID | 172_IME |
|---|---|
| ICE Name | MGIVchHai6 |
| ICEO ID | - |
| Organism | Vibrio non-O1/non-O139 cholerae HC-36A1 |
| Size | 48485 bp |
| GC Content (%) | 53.64 |
| Insertion site | trmE |
| Function | R Aminoglycoside, Beta-lactam, Phenicol, Sulphonamide, Tetracycline M Metal resistance D Restriction-Modification |
| Species that ICE can be transferred to | Enterobacteriaceae |
| Nucleotide Sequence | AXDR01000001 (complete IME sequence in this contig) |
| Coordinates | 43098..91582 |
| Putative oriT region | coordinates: 85940..85988; oriTDB id: 200079 TCCAAGATCCCCCATCAGATAGTTATTGGAAAGGAATTGGTAGGGTCTT |
| Putative relaxase | coordinates: 85145..85939; Family: Other |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of MGIVchHai6 components from AXDR01000001
Complete gene list of MGIVchHai6 from AXDR01000001
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The Interaction Network among ICE/IME/CIME
Detailed Informatioin of the Interaction Network
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
|---|---|---|---|---|---|---|
| 1 | MGIVchHai6 | pVCR94 [IncA/C plasmid] |  in trans | Vibrio cholerae HC-36A1; Escherichia coli | Escherichia coli | 27435459 |
| (1) Carraro N, Rivard N, Ceccarelli D, Colwell RR, Burrus V. (2016) IncA/C Conjugative Plasmids Mobilize a New Family of Multidrug Resistance Islands in Clinical Vibrio cholerae Non-O1/Non-O139 Isolates from Haiti. mBio. 2016 Jul 19;7(4):e00509-16. [PubMed:27435459] |
| (2) Carraro N, Rivard N, Burrus V, Ceccarelli D. (2017) Mobilizable genomic islands, different strategies for the dissemination of multidrug resistance and other adaptive traits. Mob Genet Elements. 2017 Apr 12;7(2):1-6. [PubMed:28439449] |
| (3) Guédon G, Libante V, Coluzzi C, Payot S, Leblond-Bourget N. (2017) The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 2017 Nov 22;8(11):337. [PubMed:29165361] |
| (4) Rivard N, Colwell RR, Burrus V (2020) Antibiotic Resistance in Vibrio cholerae: Mechanistic Insights from IncC Plasmid-Mediated Dissemination of a Novel Family of Genomic Islands Inserted at trmE. mSphere. 2020 Aug 26;5(4):e00748-20. [PubMed:32848007] |