Information of ICE
| ICEberg ID | 1602 |
|---|---|
| ICE Name | ICEAsp1 |
| ICEO ID | - |
| Organism | Actinobacillus strain GY-402 |
| Size | 72978 bp |
| GC Content (%) | 37.71 |
| Insertion site | tRNALeu |
| Function | R Aminoglycoside, Beta-lactam, Macrolide, Lincosamide, Streptogramin B, Phenicol, Polymyxin, Sulphonamide, Tetracycline |
| Species that ICE can be transferred to | E. coli EC600; P. multocida XNpm1R100 |
| Nucleotide Sequence | MW030510.1 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..72978 |
| Putative oriT region | coordinates: 60932..60972; oriTDB id: 100194 TGTAAAGTATACACACTATACTTTATATTCATATAAGTG |
| Putative relaxase | coordinates: 69941..71867; Family: MOBH |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICEAsp1 components from MW030510.1
Complete gene list of ICEAsp1 from MW030510.1
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICEAsp1 is not available.
| (1) Gao Y, Xia L, Pan R, Xuan H, Guo H, Song Q, Wei J, Shao D, Liu K, Li Z, Qiu Y, Ma Z, Li B (2021) Identification of mcr-1 and a novel chloramphenicol resistance gene catT on an integrative and conjugative element in an Actinobacillus strain of swine origin. Vet Microbiol. 2021 Mar;254:108983. [PubMed:33486327] |