Information of ICE
| ICEberg ID | 1458 |
|---|---|
| ICE Name | ICE_FprA2-165_rumA |
| ICEO ID | - |
| Organism | Faecalibacterium prausnitzii A2-165 strain JCM 31915 |
| Size | 47468 bp |
| GC Content (%) | 51.28[56.35] |
| Insertion site | - |
| Function | - |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | CP048437.1 (complete ICE sequence in this GenBank file) |
| Coordinates | 1761411..1808878 |
| Putative oriT region | coordinates: 33130..33157; oriTDB id: 200002 GAGTGGCTACACTCCCTATGCTTGCT |
| Putative relaxase | coordinates: 1792866..1794195; Family: MOBP1 |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICE_FprA2-165_rumA components from CP048437.1
Complete gene list of ICE_FprA2-165_rumA from CP048437.1
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICE_FprA2-165_rumA is not available.
| (1) Guédon G, Lao J, Payot S, Lacroix T, Chiapello H, Leblond-Bourget N (2022) FirmiData: a set of 40 genomes of Firmicutes with a curated annotation of ICEs and IMEs. BMC Res Notes. 2022 May 10;15(1):157. [PubMed:35538580] |
| (2) Lao J, Lacroix T, Guédon G, Coluzzi C, Payot S, Leblond-Bourget N, Chiapello H. (2022) ICEscreen: a tool to detect Firmicute ICEs and IMEs, isolated or enclosed in composite structures. NAR Genom Bioinform. 2022 Oct 21;4(4):lqac079. [PubMed:36285285] |