Information of ICE
| ICEberg ID | 126 |
|---|---|
| ICE Name | ICEKp1 |
| ICEO ID | ICEO_0000143 |
| Organism | Klebsiella pneumoniae NTUH-K2044 |
| Size | 75935 bp |
| GC Content (%) | 52.18[57.68] |
| Insertion site | tRNA-asn(KP1_6086) |
| Function | V Virulence factor |
| Species that ICE can be transferred to | Klebsiella pneumoniae;Escherichia coli |
| Nucleotide Sequence | AB298504; AP006725 (complete ICE sequence in this genome) |
| Coordinates | 3395836..3471770 |
| Putative oriT region | coordinates: 64729..64852; oriTDB id: 200013 GATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAA AAATAGGCTAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGGACGACGGTGTGCCG CC |
| Putative relaxase | - |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICEKp1 components from AP006725
Complete gene list of ICEKp1 from AP006725
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The Interaction Network among ICE/IME/CIME
Detailed Informatioin of the Interaction Network
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
|---|---|---|---|---|---|---|
| 1 | ICEKp1 | GIE492 [IME] |  - | - | - | - |
| (1) Lin TL, Lee CZ, Hsieh PF, Tsai SF, Wang JT. (2008) Characterization of integrative and conjugative element ICEKp1-associated genomic heterogeneity in a Klebsiella pneumoniae strain isolated from a primary liver abscess. J Bacteriol. 2008 Jan;190(2):515-26. [PubMed:17981959] |
| (2) Wu KM, Li LH, Yan JJ, Tsao N, Liao TL, Tsai HC, Fung CP, Chen HJ, Liu YM, Wang JT, Fang CT, Chang SC, Shu HY, Liu TT, Chen YT, Shiau YR, Lauderdale TL, Su IJ, Kirby R, Tsai SF. (2009) Genome sequencing and comparative analysis of Klebsiella pneumoniae NTUH-K2044, a strain causing liver abscess and meningitis. J Bacteriol. 2009 Jul;191(14):4492-501. [PubMed:19447910] |
| (3) Shen Z, Gao Q, Qin J, Liu Y, Li M (2019) Emergence of an NDM-5-Producing Hypervirulent Klebsiella pneumoniae Sequence Type 35 Strain with Chromosomal Integration of an Integrative and Conjugative Element, ICEKp1. Antimicrob Agents Chemother. 2019 Dec 20;64(1):e01675-19. [PubMed:31611359] |