Information of ICE
| ICEberg ID | 1253 |
|---|---|
| ICE Name | ICEKpnINF249-2 |
| ICEO ID | ICEO_0003435 |
| Organism | Klebsiella pneumoniae INF249 |
| Size | 210245 bp |
| GC Content (%) | 52.18[57.19] |
| Insertion site | - |
| Function | R Aminoglycoside, Beta-lactam, Sulphonamide M Metal resistance |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | CP024489.1 (complete ICE sequence in this genome) |
| Coordinates | 5079347..5289591 |
| Putative oriT region | coordinates: 42688..42743; oriTDB id: 100015 AGTGAAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTCATTTTGTGGTGAG |
| Putative relaxase | coordinates: 5087374..5092633; Family: MOBF |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICEKpnINF249-2 components from CP024489.1
Complete gene list of ICEKpnINF249-2 from CP024489.1
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICEKpnINF249-2 is not available.
The reference information of ICEKpnINF249-2 is not available.