Information of ICE
| ICEberg ID | 1091 |
|---|---|
| ICE Name | Trb-1 |
| ICEO ID | ICEO_0000186 |
| Organism | Legionella pneumophila Corby |
| Size | 42317 bp |
| GC Content (%) | 39.44 |
| Insertion site | tRNAPro (lpc2778) |
| Function | D Gao D Phage defense system D Restriction-Modification V Virulence factor |
| Species that ICE can be transferred to | Legionella pneumophila JR32 Sm; Legionella micdadei (ATCC 33218) |
| Nucleotide Sequence | CP000675 (complete ICE sequence in this genome) |
| Coordinates | 614497..656813 |
| Putative oriT region | coordinates: 23146..23204; oriTDB id: 100110 GAAGATTGATAGCCAGCTTGCTGGTTAGCTAACTTCACCTATCTTGCCCTGCTTTTC |
| Putative relaxase | coordinates: 635310..637175; Family: MOBP |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of Trb-1 components from CP000675
Complete gene list of Trb-1 from CP000675
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of Trb-1 is not available.
| (1) Glöckner G, Albert-Weissenberger C, Weinmann E, Jacobi S, Schunder E, Steinert M, Hacker J, Heuner K. (2008) Identification and characterization of a new conjugation/type IVA secretion system (trb/tra) of Legionella pneumophila Corby localized on two mobile genomic islands. Int J Med Microbiol. 2008 Jul;298(5-6):411-28. [PubMed:17888731] |
| (2) Lautner M, Schunder E, Herrmann V, Heuner K. (2013) Regulation, integrase-dependent excision, and horizontal transfer of genomic islands in Legionella pneumophila. J Bacteriol. 2013 Apr;195(7):1583-97. [PubMed:23354744] |