Information of ICE
| ICEberg ID | 103 |
|---|---|
| ICE Name | Tn5397 |
| ICEO ID | ICEO_0000256 |
| Organism | Clostridium difficile 630 |
| Size | 20657 bp |
| GC Content (%) | 38.32[29.06] |
| Insertion site | AT rich regions |
| Function | R Tetracycline |
| Species that ICE can be transferred to | Bacillus subtilis; Clostridium difficile |
| Nucleotide Sequence | AM180355 (complete ICE sequence in this genome) |
| Coordinates | 585384..606040 |
| Putative oriT region | coordinates: 2488..2620; oriTDB id: 200001 TTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGGCAAAAAAATAGTA GAAAATCCTTTGGTTACAAGGGATTTAGAAAATTTCGGTGTATGTCAAATGAGCTTTAAA AGTTGACATAC |
| Putative relaxase | coordinates: 588010..589218; Family: MOBT |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of Tn5397 components from AM180355
Complete gene list of Tn5397 from AM180355
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The Interaction Network among ICE/IME/CIME

Detailed Informatioin of the Interaction Network
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
|---|---|---|---|---|---|---|
| 1 | Tn5397 | Tn5398 [CIME] | | - | - | - |
| (1) Mullany P, Wilks M, Tabaqchali S. (1995) Transfer of macrolide-lincosamide-streptogramin B (MLS) resistance in Clostridium difficile is linked to a gene homologous with toxin A and is mediated by a conjugative transposon, Tn5398. J Antimicrob Chemother. 1995 Feb;35(2):305-15. [PubMed:7759394] |
| (2) Mullany P, Pallen M, Wilks M, Stephen JR, Tabaqchali S. (1996) A group II intron in a conjugative transposon from the gram-positive bacterium, Clostridium difficile. Gene. 1996 Sep 26;174(1):145-50. [PubMed:8863741] |
| (3) Roberts AP, Pratten J, Wilson M, Mullany P. (1999) Transfer of a conjugative transposon, Tn5397 in a model oral biofilm. FEMS Microbiol Lett. 1999 Aug 1;177(1):63-6. [PubMed:10436923] |
| (4) Wang H, Roberts AP, Lyras D, Rood JI, Wilks M, Mullany P. (2000) Characterization of the ends and target sites of the novel conjugative transposon Tn5397 from Clostridium difficile: excision and circularization is mediated by the large resolvase, TndX. J Bacteriol. 2000 Jul;182(13):3775-83. [PubMed:10850994] |
| (5) Wang H, Mullany P. (2000) The large resolvase TndX is required and sufficient for integration and excision of derivatives of the novel conjugative transposon Tn5397. J Bacteriol. 2000 Dec;182(23):6577-83. [PubMed:11073898] |
| (6) Roberts AP, Johanesen PA, Lyras D, Mullany P, Rood JI. (2001) Comparison of Tn5397 from Clostridium difficile, Tn916 from Enterococcus faecalis and the CW459tet(M) element from Clostridium perfringens shows that they have similar conjugation regions but different insertion and excision modules. Microbiology (Reading). 2001 May;147(Pt 5):1243-1251. [PubMed:11320127] |
| (7) Wang H, Smith MC, Mullany P. (2006) The conjugative transposon Tn5397 has a strong preference for integration into its Clostridium difficile target site. J Bacteriol. 2006 Jul;188(13):4871-8. [PubMed:16788196] |
| (8) Sebaihia M, Wren BW, Mullany P, Fairweather NF, Minton N, Stabler R, Thomson NR, Roberts AP, Cerdeño-Tárraga AM, Wang H, Holden MT, Wright A, Churcher C, Quail MA, Baker S, Bason N, Brooks K, Chillingworth T, Cronin A, Davis P, Dowd L, Fraser A, Feltwell T, Hance Z, Holroyd S, Jagels K, Moule S, Mungall K, Price C, Rabbinowitsch E, Sharp S, Simmonds M, Stevens K, Unwin L, Whithead S, Dupuy B, Dougan G, Barrell B, Parkhill J. (2006) The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome. Nat Genet. 2006 Jul;38(7):779-86. [PubMed:16804543] |
| (9) Jasni AS, Mullany P, Hussain H, Roberts AP. (2010) Demonstration of conjugative transposon (Tn5397)-mediated horizontal gene transfer between Clostridium difficile and Enterococcus faecalis. Antimicrob Agents Chemother. 2010 Nov;54(11):4924-6. [PubMed:20713671] |