Information of ICE
| ICEberg ID | 1016 |
|---|---|
| ICE Name | ICEPmiChn1 |
| ICEO ID | ICEO_0000018 |
| Organism | Proteus mirabilis |
| Size | 92751 bp |
| GC Content (%) | 48.01 |
| Insertion site | prfC |
| Function | D Abortive infection/Phage exclusion systems D Phage defense system R Phenicol, Sulphonamide, Tetracycline D Restriction-Modification D RosmerTA |
| Species that ICE can be transferred to | Escherichia coli |
| Nucleotide Sequence | KT962845 (complete ICE sequence in this GenBank file) |
| Coordinates | 1..92751 |
| Putative oriT region | coordinates: 3990..4096; oriTDB id: 200056 TCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGC CAAACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA |
| Putative relaxase | coordinates: 38622..40772; Family: MOBH |
Function tags R Antibiotic resistance V Virulence factor M Metal resistance D Defense system G Degradation S Symbiosis
The graph information of ICEPmiChn1 components from KT962845
Complete gene list of ICEPmiChn1 from KT962845
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | Reannotation | Rea |
|---|
The interaction information of ICEPmiChn1 is not available.
| (1) Lei CW, Zhang AY, Wang HN, Liu BH, Yang LQ, Yang YQ. (2016) Characterization of SXT/R391 Integrative and Conjugative Elements in Proteus mirabilis Isolates from Food-Producing Animals in China. Antimicrob Agents Chemother. 2016 Jan 11;60(3):1935-8. [PubMed:26824957] |
| (2) Badhai J, Das SK. (2016) Characterization of Three Novel SXT/R391 Integrating Conjugative Elements ICEMfuInd1a and ICEMfuInd1b, and ICEMprChn1 Identified in the Genomes of Marinomonas fungiae JCM 18476(T) and Marinomonas profundimaris Strain D104. Front Microbiol. 2016 Nov 25;7:1896. [PubMed:27933056] |
| (3) Ryan MP, Armshaw P, O'Halloran JA, Pembroke JT. (2017) Analysis and comparative genomics of R997, the first SXT/R391 integrative and conjugative element (ICE) of the Indian Sub-Continent. Sci Rep. 2017 Aug 17;7(1):8562. [PubMed:28819148] |